View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3582_low_78 (Length: 278)
Name: NF3582_low_78
Description: NF3582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3582_low_78 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 18 - 271
Target Start/End: Original strand, 31098081 - 31098334
Alignment:
| Q |
18 |
aattgaatctcagtatgtgaacacatcaccttctcatgttatgtccgtaaacaatcaacttcaactctgcacaaagggagaaaaatcaatcaccgattac |
117 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31098081 |
aattgaatctcggtatgtgaacacatcaccttctcatgttatgtccgtaaacaatcaacttcaactctgcacaaagggagaaaaatcaatcaccgattac |
31098180 |
T |
 |
| Q |
118 |
ttgttgttctcatttaaaagtcttgcggatgaacttgttgttattgattgaacccttttagatgatgattttacccttcatattctgaatggtctttgca |
217 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31098181 |
ttgttgttctcatttagaagtcttgcggatgaacttgttgttattgattgaacccttttagatgatgattttacccttcatattatgaatggtctttgca |
31098280 |
T |
 |
| Q |
218 |
cttaaaatcgcggcacttcagactccattcgcacatgtcaacacccctttgctt |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31098281 |
cttaaaatcgcggcacttcagactccattcgcacatgtcaacacccctttgctt |
31098334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University