View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3582_low_83 (Length: 268)
Name: NF3582_low_83
Description: NF3582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3582_low_83 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 17996363 - 17996115
Alignment:
| Q |
1 |
gaaggctttggcgtcaccgctactccggggaaatcgttcaaaaatgcgttgacgttggagaaggataattttccggttatgaatggggtttctccaacat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| || ||||||||||| ||||||||| |
|
|
| T |
17996363 |
gaaggctttggcgtcaccgctactccggggaaatcgttcaaaaatgcgttgacgttggaaaaggataattttccgattttgaatggggttgctccaacat |
17996264 |
T |
|
| Q |
101 |
tggaaattcttccatcggaggatatgctggactatttgcagtgggcctttataggggaactgttccatcataatgatgttttggaggtgcaacaagcttt |
200 |
Q |
| |
|
|||||||| |||||||| |||| ||||| ||||||||||||||| ||||||| ||||||||||||||||| || |||| ||||||||||||||||||||| |
|
|
| T |
17996263 |
tggaaattgttccatcgaaggagatgctagactatttgcagtggacctttatgggggaactgttccatcagaaggatgctttggaggtgcaacaagcttt |
17996164 |
T |
|
| Q |
201 |
ggttatggaaggcattcaaggtgttaaagtcacagagatgggagacaga |
249 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
17996163 |
ggttatggaaggcattcgaggtgttaaagtcatagagatgggagacaga |
17996115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University