View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3582_low_84 (Length: 267)
Name: NF3582_low_84
Description: NF3582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3582_low_84 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 24 - 267
Target Start/End: Original strand, 38964311 - 38964554
Alignment:
| Q |
24 |
ttgatatttgtttaattgttgttgattagaaattaatatagataagatagatatagaagtgccaacggaagttggttcagttggtcaagagttgacacgt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38964311 |
ttgatatttgtttaattgttgttgattagaaattaatatagataagatagatatagaagtgccaacggaagttggttcagttggtcaagagttgacacgt |
38964410 |
T |
|
| Q |
124 |
aaaccacaagggtgcaaagttcaactccggctgttggcgtgaggaccttgttggggggtgatttgtaaatacgtaggttaatgctctctgtctgtctctg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38964411 |
aaaccacaagggtgcaaagttcaactccggctgttggcgtgaggaccttgttggggggtgatttgtaaatacgtaggttagtgctctctgtctgtctctg |
38964510 |
T |
|
| Q |
224 |
agacttggggactgtattgacctttggaagcccccagatttcat |
267 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38964511 |
agacatggggactgtattgacctttggaagcccccagatttcat |
38964554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University