View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3582_low_89 (Length: 254)
Name: NF3582_low_89
Description: NF3582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3582_low_89 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 5e-77; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 84 - 233
Target Start/End: Original strand, 6989134 - 6989283
Alignment:
| Q |
84 |
tcgaaatattcatcttctcaacttaattgatgtgtgtgattttcacacatgtgtcacaaagtcattgataatcgagctacacctgaagtcccacacatgt |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6989134 |
tcgaaatattcatcttctcaacttaattgatgtgtgtgattttcacacatgtgtcacaaagtcattgataatcgagctacacctgaagtcccacacatgt |
6989233 |
T |
 |
| Q |
184 |
gtcacaacttcattggtgaatatctcttgctatgcagtaagggagcaaca |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6989234 |
gtcacaacttcattggtgaatatctcttgctaggcagtaagggagcaaca |
6989283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 9 - 94
Target Start/End: Original strand, 6989029 - 6989114
Alignment:
| Q |
9 |
aaatttaatatatttacccactttcttaatataaataggaccgaaggaagtgatatattgaatgctcgttcaaattcgaaatattc |
94 |
Q |
| |
|
|||||||||||| ||| ||||||| ||||||||||||||| |||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6989029 |
aaatttaatatacttatccacttttttaatataaataggatcgaatgaagtaatatattgaatgctcgttcaaattcgaaatattc |
6989114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University