View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3582_low_91 (Length: 254)
Name: NF3582_low_91
Description: NF3582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3582_low_91 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 7 - 237
Target Start/End: Complemental strand, 5939946 - 5939717
Alignment:
| Q |
7 |
ccccacaaaatgcacatttggagtccaagctgagaaattcctaggattcatgctgacaaggcgaggaatagaggcgaaccccgacaaattccaagccata |
106 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5939946 |
ccccagaaaatgcacatttggagtccaagctgagaaattcctaggattcatgttgacaaggcgaggaataggggcgaaccccgacaaattccaagccata |
5939847 |
T |
|
| Q |
107 |
attaacatgagaagcccccaccaccataagggcgaagtgttttaagggaaatcataacgatccaaggtgggaaaagaatttcacttctcgtcatccttct |
206 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
5939846 |
attaacatgagaag-ccccaccatcataagggcgaagtgttttaagggaaatcataacgatccaaggcgggaaaagaatttcacttttcgtcatccttct |
5939748 |
T |
|
| Q |
207 |
ttaatagtggaacttgtataatctagttctt |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
5939747 |
ttaatagtggaacttgtataatctagttctt |
5939717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 170 - 225
Target Start/End: Complemental strand, 5973682 - 5973627
Alignment:
| Q |
170 |
aaggtgggaaaagaatttcacttctcgtcatccttctttaatagtggaacttgtat |
225 |
Q |
| |
|
||||||||||||||||||| |||| | ||||||||||| |||| |||||||||||| |
|
|
| T |
5973682 |
aaggtgggaaaagaatttctcttcacatcatccttcttcaataatggaacttgtat |
5973627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University