View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3582_low_92 (Length: 254)

Name: NF3582_low_92
Description: NF3582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3582_low_92
NF3582_low_92
[»] chr2 (2 HSPs)
chr2 (161-243)||(4536918-4537000)
chr2 (84-113)||(4537049-4537078)


Alignment Details
Target: chr2 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 161 - 243
Target Start/End: Complemental strand, 4537000 - 4536918
Alignment:
161 tatgaatggctttgcaactgttgagaaatcgcacttcagcgtcaacgttcaatttgttcaccaatgctcttagacgtttctct 243  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4537000 tatgaatggctttgcaactgttgagaaatcgcacttcagcgtcaacgttcaatttgttcaccaatgctcttagacgtttctct 4536918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 84 - 113
Target Start/End: Complemental strand, 4537078 - 4537049
Alignment:
84 gcttcactgcactgttgcaacttgtatatg 113  Q
    ||||||||||||||||||||||||||||||    
4537078 gcttcactgcactgttgcaacttgtatatg 4537049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University