View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3582_low_94 (Length: 251)
Name: NF3582_low_94
Description: NF3582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3582_low_94 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 8 - 235
Target Start/End: Complemental strand, 6011705 - 6011478
Alignment:
| Q |
8 |
ccatgacaggagtttacttaaatagtcataaccattgtaattcaaaaattgaacgtgctaaaaaatggacggttcaaccagttaaaccatgaactgagat |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6011705 |
ccatgacaggagtttacttaaatagtcataaccattgtaattcaaaaattgaacgtgctaaaatatggacagttcaaccagttaaaccatgaactgagat |
6011606 |
T |
 |
| Q |
108 |
tgcctccggttcggttatttgggtgattcaactgcggtttcattccagcttgaaatttgaatagtttaaagacattaactatgactcataggtctcgtca |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6011605 |
tgcctccggttcggttatttgggtgattcaactgcgatttcatcccagcttgaaatttgaatagtttaaagacattaactatgactcataggtctcgtca |
6011506 |
T |
 |
| Q |
208 |
gtttgatgtccggttcaatttctaaaac |
235 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
6011505 |
gtttgatgtccggttcaatttctaaaac |
6011478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University