View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3582_low_97 (Length: 251)
Name: NF3582_low_97
Description: NF3582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3582_low_97 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 16 - 235
Target Start/End: Complemental strand, 10405395 - 10405167
Alignment:
| Q |
16 |
atagagcaattgatcacacctatgtataatagctagtagcatgctgacaagtttatatatcttcaaaagatttatcaatcttggaacttggctgtataat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10405395 |
atagagcaattgatcacacctatgtataatagctagtagcatgctgacaagtttatatatcttcaaaagatttatcaatcttggaacttggctgtataat |
10405296 |
T |
 |
| Q |
116 |
ccagatcgaggagctcgaaggtggaatgcaccaattttcagatacattccttctcgaaaattgacggtgatcgtgcttcttctttattcaac-------- |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10405295 |
ccagatcgaggagctcgaaggtggaatgcaccaattttcagatacattccttctcgaaaattgacggtgatcgtgcttcttctttattcaacacttccaa |
10405196 |
T |
 |
| Q |
208 |
-tagagaactcacactcctataaagattt |
235 |
Q |
| |
|
||||||| |||||||||||||||||||| |
|
|
| T |
10405195 |
atagagaattcacactcctataaagattt |
10405167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University