View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3583_high_6 (Length: 304)
Name: NF3583_high_6
Description: NF3583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3583_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 84; Significance: 6e-40; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 3 - 90
Target Start/End: Original strand, 34566913 - 34567000
Alignment:
| Q |
3 |
catgtactggattttttatatttttataaagtgatctttctttttaaattgaattcaacgtaaaagaaaagaaattcaatatgaatcg |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34566913 |
catgtactggattttttatatttttataaagtgatctttctttttaaattgaattcaatgtaaaagaaaagaaattcaatatgaatcg |
34567000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 204 - 294
Target Start/End: Original strand, 34567167 - 34567258
Alignment:
| Q |
204 |
agaatgacagaaagtttatct-gcttgcaaatgaatatatgatacttcaagctacttatgatgacgtagagtgatttggtagttatcctttg |
294 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34567167 |
agaatgacagaaagtttatcttgcttgcaaatgaatatatgatacttcaagctacttatgatgacgtagagtgatttggtagttatcctttg |
34567258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University