View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3584_high_10 (Length: 296)

Name: NF3584_high_10
Description: NF3584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3584_high_10
NF3584_high_10
[»] chr5 (2 HSPs)
chr5 (1-201)||(10444250-10444450)
chr5 (227-285)||(10444448-10444506)


Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 10444250 - 10444450
Alignment:
1 cactattaagtaaattgacatgtttacgtgtttattttcagagatttggcaatttccatcagaggcctaatgcaggttatggtgattatggcgttggacg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
10444250 cactattaagtaaattgacatgtttacgtgtttattttcagagatttggcaatttccatcagaggcctaatgcaggttatggtgattatggcgctggacg 10444349  T
101 cggtgagaatttcaggggctatttgggaaggggttatggttatggcgggagagggcatggaccaaacttccctttctagcggtatccctattttctgtta 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
10444350 cggtgagaatttcaggggctatttgggaaggggttatggttatggcgggagagggcatggaccaaacttccctttctagtggtatccctattttctgtta 10444449  T
201 a 201  Q
    |    
10444450 a 10444450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 227 - 285
Target Start/End: Original strand, 10444448 - 10444506
Alignment:
227 taaactttcctttattttctgctcgatcgttggctttatgccaacggtgtttacatatt 285  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10444448 taaactttcctttattttctgctcgatcgttggctttatgccaacggtgtttacatatt 10444506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University