View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3584_high_18 (Length: 256)
Name: NF3584_high_18
Description: NF3584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3584_high_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 45024612 - 45024853
Alignment:
| Q |
1 |
aaacttaaaaatgttaacatttatttactatattacattactctattaattgcagtctttattttagatagcttttcctctgttagaggtaattttattt |
100 |
Q |
| |
|
|||||| ||||||||||| |||||||| ||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45024612 |
aaacttgaaaatgttaacgtttatttattatattacattactctattaattgcggtctttattttagataatttttcctctgttagaggtaattttattt |
45024711 |
T |
|
| Q |
101 |
gagatatgtttgttgatatcaagtgtgaacatcttttttagttaagatgtaaactttattttgtcatgttgtatgaggctgactcattatgccaaacaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45024712 |
gagatatgtttgttgatatcaagtgtgaacatctttgttagttaagatgtgaactttattttgtcatgttttatgaggctgactcattatgccaaacaca |
45024811 |
T |
|
| Q |
201 |
atttctgatgattaagttttttattttctaatagtacttatt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45024812 |
atttctgatgattaagttttttattttctaatagtacttatt |
45024853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University