View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3584_high_27 (Length: 248)
Name: NF3584_high_27
Description: NF3584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3584_high_27 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 19 - 248
Target Start/End: Complemental strand, 34819222 - 34818993
Alignment:
| Q |
19 |
actccgagagcattaattgagatggctgaatgacggtttaaaggagggattcaaatgtcaactagagtgagtcagaaacattaattatccctcacaatgt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34819222 |
actccgagagcattaattgagatggctgaatgacggtttaaaggagggattcaaatgtcaactagagtgagtcagaaacattaattatccctcgcaatgt |
34819123 |
T |
 |
| Q |
119 |
caaaccacccccacatgaacatgaataataccctactc-aggagccaatcctctcgaaaggtaaaaacaagagtcaagagaagaaagcatccaacatttt |
217 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34819122 |
caaaccacccccac-tgaacatgaacaataccctactcaaggagccaatcctctcgaaaggtaaaaacaagagtcaagagaagaaagcatccaacatttt |
34819024 |
T |
 |
| Q |
218 |
ggaatagtagttgccaccctcttgagatgac |
248 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |
|
|
| T |
34819023 |
ggaatagtagctgccaccctcttgagatgac |
34818993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University