View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3584_high_35 (Length: 236)
Name: NF3584_high_35
Description: NF3584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3584_high_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 18 - 222
Target Start/End: Complemental strand, 25331613 - 25331408
Alignment:
| Q |
18 |
atgcaattatgtcaaaattttatgagattaaaaacacacaaatatgttaaagaaagaaaaa-ttgaactctaactgttgtctgaatttgaatcatattcg |
116 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| || |
|
|
| T |
25331613 |
atgcaattatgccaaaattttatgagattaaaaacacacaaatatgttaaagaaagaaaaaattgaactctaactgttgtctgaatttgaatcatatgcg |
25331514 |
T |
 |
| Q |
117 |
ctgtggaaatttttcttgtgataggaacaaccgatgctattatagaaagaatcatttctttttctttcatttctgcctgttcttctttgttatgtctcta |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25331513 |
ctgtggaaatttttcttgtgataggaacaactgatgctattatagaaagaatcatttctttttctttcatttctgcttgttcttctttgttatgtctcta |
25331414 |
T |
 |
| Q |
217 |
ttaagt |
222 |
Q |
| |
|
|||||| |
|
|
| T |
25331413 |
ttaagt |
25331408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University