View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3584_high_8 (Length: 299)
Name: NF3584_high_8
Description: NF3584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3584_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 123 - 283
Target Start/End: Complemental strand, 49472071 - 49471915
Alignment:
| Q |
123 |
gaaacttaacagtgagaggagtgagtgagtgataattaaagaaacagtagagtacaggagaaaacggggttccttccttctttccttcaagttgaaattt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49472071 |
gaaacttaacagtgagaggagtgagtga----taattaaagaaacagtagagtacaggagaaaacggggttccttccttctttccttcaagttgaaattt |
49471976 |
T |
 |
| Q |
223 |
aattgtccagatcagatcatgtcgctttccactaatagtcgcacaaggtcacattctttct |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49471975 |
aattgtccagatcagatcatgtcgctttccactaatagtcgcacaaggtcacattctttct |
49471915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 13 - 74
Target Start/End: Complemental strand, 49472168 - 49472107
Alignment:
| Q |
13 |
gagagaccgaccaacaagatccgaaagattcaaactgttgttttgatttatcttcttctatc |
74 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
49472168 |
gagagaccgaccaacaagatccgaaagattcaaacagttgttttgatttatcttcttctatc |
49472107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University