View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3584_low_11 (Length: 296)
Name: NF3584_low_11
Description: NF3584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3584_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 10444250 - 10444450
Alignment:
| Q |
1 |
cactattaagtaaattgacatgtttacgtgtttattttcagagatttggcaatttccatcagaggcctaatgcaggttatggtgattatggcgttggacg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10444250 |
cactattaagtaaattgacatgtttacgtgtttattttcagagatttggcaatttccatcagaggcctaatgcaggttatggtgattatggcgctggacg |
10444349 |
T |
|
| Q |
101 |
cggtgagaatttcaggggctatttgggaaggggttatggttatggcgggagagggcatggaccaaacttccctttctagcggtatccctattttctgtta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10444350 |
cggtgagaatttcaggggctatttgggaaggggttatggttatggcgggagagggcatggaccaaacttccctttctagtggtatccctattttctgtta |
10444449 |
T |
|
| Q |
201 |
a |
201 |
Q |
| |
|
| |
|
|
| T |
10444450 |
a |
10444450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 227 - 285
Target Start/End: Original strand, 10444448 - 10444506
Alignment:
| Q |
227 |
taaactttcctttattttctgctcgatcgttggctttatgccaacggtgtttacatatt |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10444448 |
taaactttcctttattttctgctcgatcgttggctttatgccaacggtgtttacatatt |
10444506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University