View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3584_low_16 (Length: 267)
Name: NF3584_low_16
Description: NF3584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3584_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 15 - 266
Target Start/End: Original strand, 10443887 - 10444138
Alignment:
| Q |
15 |
tggaagacattgagtttctcaatttgggtgaacgagaatgtcacaaattaaaggtatgacatggttatggtatgtttgcgtttgatgataattttctcct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10443887 |
tggaagacattgagtttctcaatttgggtgaacgagaatgtcacaaattaaaggtatgacatggttatggtatgtttgcgtttgatgataattttctcct |
10443986 |
T |
 |
| Q |
115 |
cttgatttgttgaaaggagcatgaattgaactaagtaacatgcttgtggcagtataaaacaagttgtatttgaacttgaatgaaaacttatgacttgctt |
214 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10443987 |
cttgatttgttgaaaggagcatgaattaaactaagtaacatgcttgtggcagtataaaacaagttgtatttgaacttgaatgaaaacttatgacttgctt |
10444086 |
T |
 |
| Q |
215 |
ttacttgcagtctgcatacaaaaaagatgacttttttgacacaatttcttct |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10444087 |
ttacttgcagtctgcatacaaaaaagatgacttttttgacacaatttcttct |
10444138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University