View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3584_low_18 (Length: 261)
Name: NF3584_low_18
Description: NF3584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3584_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 6411238 - 6411483
Alignment:
| Q |
1 |
tgcgccacctccgaccatatcatccactcgcatgtcaaccatcatttcaaacaccacctaccaccattctggacgtcttgaccatgtattcatcgatcag |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| || |
|
|
| T |
6411238 |
tgcgccacctccgaccatatcgtccactcgcatgtcaaccatcatttcaaacaccacctaccgccattctggacgtcttgaccatgtattcctcgattag |
6411337 |
T |
 |
| Q |
101 |
gtgatcaccacattgaccactactacgataaccactccaaccgccaccttttaactattttaaccacctgtccactaatcacgacttcgacaaccatcta |
200 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| || ||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
6411338 |
gtgatcaccacattgaccactactatgataaccactctaaccgccaccttttaactattgcaaacacctatccactaatcacgacttcgacaactatcta |
6411437 |
T |
 |
| Q |
201 |
tcggcacctcagacaaccaccacttataatcactattaatgaaatt |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6411438 |
tcggcacctcagacaaccaccacttataatcactattaatgaaatt |
6411483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University