View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3584_low_26 (Length: 250)
Name: NF3584_low_26
Description: NF3584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3584_low_26 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 29 - 250
Target Start/End: Complemental strand, 18184573 - 18184354
Alignment:
| Q |
29 |
actgataagatacatgatcataatcataaaattaacatgaagtttcaataacaatgtctaaacttagtaagattcttccaccaaaaatgaaaagcacaaa |
128 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18184573 |
actgatgagatacatgatcatagtcataaaattaacatgaagttacaataacaatgtctaaacttagtaagattcttccaccaaaaatgaaaagcacaaa |
18184474 |
T |
 |
| Q |
129 |
gtagaaactagatgattttatcatattacatgaagagtgtaaacaaaaccactcatagttgtaaacaaaacacacacaaaccgttcaaatctcaaaacct |
228 |
Q |
| |
|
||||||||||||| ||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
18184473 |
gtagaaactagataattttatcaaattacatg--gagtgtaaacaaaaccactcatagttgtaaacaaaacacacacaaaccgttcaaatctcaaaatct |
18184376 |
T |
 |
| Q |
229 |
taccaaatctacaacaaataat |
250 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
18184375 |
taccaaatctacaacaaataat |
18184354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University