View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3584_low_30 (Length: 245)
Name: NF3584_low_30
Description: NF3584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3584_low_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 4 - 199
Target Start/End: Original strand, 239303 - 239498
Alignment:
| Q |
4 |
ccacaaatcggaatctagactgcgactttgaattaaaacgttcttaatgcttaagtttctattctttcattccacactttgatcattgctgcttcaaatt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
239303 |
ccacaaatcggaatctagactgcgactttgaattaaaacgttcttaatgcttaagtttctattctttcattccacactttgatcattgctgcttcaaatt |
239402 |
T |
 |
| Q |
104 |
aatccaatccaagtgtagatgggaaaatatatgagagcactttctgtatgttttctcttatgctctttggtcatgatatatcttgcacgatattaa |
199 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
239403 |
aatccaatccaagtatcgatgggaaaatatatgagagcactttctgtatgttttctcttatgctctttggtcatgatatatcttgcacgatattaa |
239498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University