View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3584_low_32 (Length: 240)
Name: NF3584_low_32
Description: NF3584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3584_low_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 22559673 - 22559761
Alignment:
| Q |
1 |
ataaggtagacttagcaagaggttccttagaattgggtctggtttcaaattctcatatggtaatcttccatgaacaaagctgtagtaac |
89 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22559673 |
ataaggtaggcttagcaagaggttccttagaattgggtctggtttcaaattctcatatggtaatcttccatgaacaaagctgtagtaac |
22559761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 151 - 226
Target Start/End: Original strand, 22559824 - 22559899
Alignment:
| Q |
151 |
tatataaaatagttactaatttagaagagatgatgtataaaaagtttgaaaaagaaagtcatgtacctgtgatatt |
226 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22559824 |
tatataaaatagttactaatttagaagtgatgatgtataaaaagtttgaaaaagaaagtcatgtacctgtgatatt |
22559899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 8 - 78
Target Start/End: Complemental strand, 7277329 - 7277259
Alignment:
| Q |
8 |
agacttagcaagaggttccttagaattgggtctggtttcaaattctcatatggtaatcttccatgaacaaa |
78 |
Q |
| |
|
||||| ||||| || ||||| | ||| |||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
7277329 |
agactcagcaacagattcctcaaaatagggtctggtttcaagttctcataaggtaatcttccatgaacaaa |
7277259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 23 - 78
Target Start/End: Original strand, 7302024 - 7302079
Alignment:
| Q |
23 |
ttccttagaattgggtctggtttcaaattctcatatggtaatcttccatgaacaaa |
78 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| |||| |||||||| ||||||||||| |
|
|
| T |
7302024 |
ttccttagaactgggtctggtttcaagttcacataaggtaatctcccatgaacaaa |
7302079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University