View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3584_low_34 (Length: 239)
Name: NF3584_low_34
Description: NF3584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3584_low_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 15 - 141
Target Start/End: Original strand, 23598738 - 23598864
Alignment:
| Q |
15 |
atacaaacacaaacaagacccattgtagagaaggggtcttttctgcagcccatctgtttcacacacttctattcagtaagctcaannnnnnnncctgcca |
114 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
23598738 |
atacaaacacaaacaaaacccattgtagagaaggggtcttttctgcagcccatctgtttcacactcttctattcagtaagctcaattttctttcctgcca |
23598837 |
T |
 |
| Q |
115 |
ttttgtgcttcttttcccattttccca |
141 |
Q |
| |
|
|||| |||||||||||||||||||||| |
|
|
| T |
23598838 |
ttttttgcttcttttcccattttccca |
23598864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University