View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3585_high_3 (Length: 306)
Name: NF3585_high_3
Description: NF3585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3585_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 1 - 287
Target Start/End: Original strand, 32291308 - 32291596
Alignment:
| Q |
1 |
atgtgacgctcggattgggggatttgttggttctgaagtcatacttagattagaactatggg-tgacagcattgattgttgtgtagtggtggtgtatgtc |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32291308 |
atgtgacgctcggattgggggatttgttggttctgaagtcatacttagattagaactatggggtgacagcattgattgttgtgtagtggtggtgtatgtc |
32291407 |
T |
 |
| Q |
100 |
ggttactttattccaaaacagcaaataaaagcaaaacttgtg-cagatgaatatacacaaacttgtttccacgcacacaacacatgcacgctttaatttc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32291408 |
ggttactttattccaaaacagcaaataaaagcaaaacttgtggcagatgaatatacacaaacttgtttccacgcacacaacacatgcacgctttaatttc |
32291507 |
T |
 |
| Q |
199 |
atttcttcgatgtatggaaatggtgctactactgttatgcttgcttgcttactgtgttgcctgttcattgcaattcacaacacgttttt |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32291508 |
atttcttcgatgtatggaaatggtgctactactgttatgcttgcttgcttactgtgttgcctgttcattgcaattcacaacacgttttt |
32291596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University