View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3586_high_13 (Length: 306)
Name: NF3586_high_13
Description: NF3586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3586_high_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 99; Significance: 7e-49; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 130 - 228
Target Start/End: Complemental strand, 33828039 - 33827941
Alignment:
| Q |
130 |
cagattctgtttttctgcccaaaccccgagtgagtgtgtgtgcaagcacaagcacatccagcaagaaaagaagaaaataaaaactcaaaacaccatgca |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33828039 |
cagattctgtttttctgcccaaaccccgagtgagtgtgtgtgcaagcacaagcacatccagcaagaaaagaagaaaataaaaactcaaaacaccatgca |
33827941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 15 - 94
Target Start/End: Complemental strand, 33828154 - 33828075
Alignment:
| Q |
15 |
gagggacaggtggtgagattgatggatggttttaagtttgtttgttagctttgaaaatcatatgttttccgttccctttg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33828154 |
gagggacaggtggtgagattgatggatggttttaagtttgtttgttagctttgaaaatcatatgttttccgttccctttg |
33828075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 253 - 293
Target Start/End: Complemental strand, 33827916 - 33827876
Alignment:
| Q |
253 |
gacaacccacacgagcggttctcgaactctatgtactgtgt |
293 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33827916 |
gacaacccacacgagcggttttcgaactctatgtactgtgt |
33827876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University