View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3586_high_16 (Length: 265)
Name: NF3586_high_16
Description: NF3586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3586_high_16 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 19 - 265
Target Start/End: Original strand, 55091094 - 55091340
Alignment:
| Q |
19 |
ctctatatgttatcatatgccattgccggtgttagttatgtggttacttcattcatgtatcctcaatcctcaattctgtttgaaaaaccaagaatcacat |
118 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55091094 |
ctctatatattatcatatgccattgccagtgttagttttgtggttacttcattcatgtatcctcaatcctcaattctgtttgaaaaaccaagaatcacat |
55091193 |
T |
 |
| Q |
119 |
cctcctgactcacacaagcacaagtaccgaatataattttctgcaacagaaattggaatggatatgtaccattgtacttgcatcacagaatagagtaagt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55091194 |
cctcctgactcacacaagcacaagtaccgaatataattttctgcaacagaaattggaatggatatgtaccattgtacttgcatcacagaatagagtaagt |
55091293 |
T |
 |
| Q |
219 |
ataactggtgtcagaatacgcgaaattgaacttgatatgtacctttt |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
55091294 |
ataactggtgtcagaatacgcgaaattgaaattgatatgtacctttt |
55091340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University