View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3586_low_14 (Length: 306)

Name: NF3586_low_14
Description: NF3586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3586_low_14
NF3586_low_14
[»] chr7 (3 HSPs)
chr7 (130-228)||(33827941-33828039)
chr7 (15-94)||(33828075-33828154)
chr7 (253-293)||(33827876-33827916)


Alignment Details
Target: chr7 (Bit Score: 99; Significance: 7e-49; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 130 - 228
Target Start/End: Complemental strand, 33828039 - 33827941
Alignment:
Q  130 cagattctgtttttctgcccaaaccccgagtgagtgtgtgtgcaagcacaagcacatccagcaagaaaagaagaaaataaaaactcaaaacaccatgca 228  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33828039 cagattctgtttttctgcccaaaccccgagtgagtgtgtgtgcaagcacaagcacatccagcaagaaaagaagaaaataaaaactcaaaacaccatgca 33827941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 15 - 94
Target Start/End: Complemental strand, 33828154 - 33828075
Alignment:
Q  15 gagggacaggtggtgagattgatggatggttttaagtttgtttgttagctttgaaaatcatatgttttccgttccctttg 94  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33828154 gagggacaggtggtgagattgatggatggttttaagtttgtttgttagctttgaaaatcatatgttttccgttccctttg 33828075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 253 - 293
Target Start/End: Complemental strand, 33827916 - 33827876
Alignment:
Q  253 gacaacccacacgagcggttctcgaactctatgtactgtgt 293  Q
    |||||||||||||||||||| ||||||||||||||||||||    
T  33827916 gacaacccacacgagcggttttcgaactctatgtactgtgt 33827876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University