View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3586_low_23 (Length: 250)
Name: NF3586_low_23
Description: NF3586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3586_low_23 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 16 - 250
Target Start/End: Complemental strand, 55091562 - 55091332
Alignment:
| Q |
16 |
atataacattacgagtgttgaaaataaaatgtctaaatatttctattgaagattttagatttaaataagacatcactaaaaattataatttatagtttaa |
115 |
Q |
| |
|
||||||||||||||||||||||| |||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55091562 |
atataacattacgagtgttgaaa-taaaatatttaaatatttctattgaagattttagatttaaataagacatcactaaaaattataatttatagtttaa |
55091464 |
T |
 |
| Q |
116 |
ttagggtatttttaggatttgttctttattcaattcaaagatatgatttttaaaaatatacttggcaagaannnnnnnncatatcaaaatcaaattacta |
215 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
55091463 |
ttagggtatttttaagatttgttctttattcaattcaaagatatga--tttaaaaatatacttggcaagaa-tttttttcatatcaaaatcaaattacta |
55091367 |
T |
 |
| Q |
216 |
tatctcttataatttttgcaagtacaaaaaggtac |
250 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
55091366 |
tatctcttacaatttttgcaagtacaaaaaggtac |
55091332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University