View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3587_high_16 (Length: 227)
Name: NF3587_high_16
Description: NF3587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3587_high_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 6 - 150
Target Start/End: Complemental strand, 42214099 - 42213955
Alignment:
| Q |
6 |
ataaaatatacaaggttatcctatgacagattgtgcacccaacttatgggattaagctgctcagatacatccttgaaagttgaagaatccggataaaaat |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42214099 |
ataaaatatacaaggttatcctatgacagattgtgcacccaacttatgggattaagctgctcagatacatccttgaaagttgaagaatccggataaaaat |
42214000 |
T |
 |
| Q |
106 |
aactgtcaacagaactattttaagaaaccaacttccccgggaggg |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42213999 |
aactgtcaacagaactattttaagaaaccaacttccccgggaggg |
42213955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University