View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3587_high_18 (Length: 218)
Name: NF3587_high_18
Description: NF3587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3587_high_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 42213633 - 42213427
Alignment:
| Q |
1 |
gcaacggcatccactagatttgtgcctgggcataggaactgttcttgtttcttttcctgtaaagcggtgatatgagaagctgttgaagataccttggtga |
100 |
Q |
| |
|
||||| ||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42213633 |
gcaactgcatccactagatttttgcctgggcagaggaactgttcttgtttcttttcctgtaaagctgtgatatgagaagctgttgaagataccttggtga |
42213534 |
T |
|
| Q |
101 |
tggaagtggaatgtaattgaagcctgggttcttccttgactacagaagcataaccattacaattaactgcaggtccatggaacttttcaatggtgcgcca |
200 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42213533 |
tggaagtggaatgtaattgaagcccgggttcttccttgactacagaagcataaccattacaattaactgcaggtccatggaacttttcaatagtgcgcca |
42213434 |
T |
|
| Q |
201 |
tcttggt |
207 |
Q |
| |
|
||||||| |
|
|
| T |
42213433 |
tcttggt |
42213427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University