View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3587_low_10 (Length: 265)
Name: NF3587_low_10
Description: NF3587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3587_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 19 - 254
Target Start/End: Original strand, 25824087 - 25824325
Alignment:
| Q |
19 |
atgcatgttccaatttgagaaata---aattagatcatttattccataaactttcttattttatctttatcccatgcagttatgcacccactttagaaat |
115 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25824087 |
atgcatgttccaatttgagaaataataaattagatcatttattgcataaactttcttattttatctttatcccatgcagttatgcacccactttagaaat |
25824186 |
T |
|
| Q |
116 |
tgattatgattgagaattttagttaaacacatgcaggtggggatcatttggtgacccaaatggggtttataaaagagttgaaatgctgagagtgtacgaa |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
25824187 |
tgattatgattgagaattttagttaaacacatgcaggtggggatcatttggtgacccaaatggggtttataaaagagttgaaatgctgagagtatacgaa |
25824286 |
T |
|
| Q |
216 |
atggctatgagaacatggtctgattggttggaagttcat |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25824287 |
atggctatgagaacatggtctgattggttggaagttcat |
25824325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 204 - 250
Target Start/End: Complemental strand, 4076103 - 4076057
Alignment:
| Q |
204 |
agagtgtacgaaatggctatgagaacatggtctgattggttggaagt |
250 |
Q |
| |
|
||||| || |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4076103 |
agagtctatgaaatggccttgagaacatggtctgattggttggaagt |
4076057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University