View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3587_low_8 (Length: 315)
Name: NF3587_low_8
Description: NF3587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3587_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 23 - 225
Target Start/End: Complemental strand, 47426689 - 47426487
Alignment:
| Q |
23 |
cagagaaacaagtctatagaatttgcttctttgaagcaaaatatgttgtcaaactcagcacgctatgatcattgggttgttaattcaatgaaggagagta |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47426689 |
cagagaaacaagtctatagaatttgcttctttgaagcaaaatatgttgtcaaactcagcacgctatgatcattgggttgttaattcaatgaaggagagta |
47426590 |
T |
|
| Q |
123 |
agcatgattcctttggtagctatgcggttactactagtgatgattcctattattactcgtgaattcttgaatggtacaaagtaagcaaagattcaatatt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47426589 |
agcatgattcctttggtagctatgcggttactactagtgatgattcctattattactcgtgaattcttgaatggtacaaagtaagcaaagattcaatatt |
47426490 |
T |
|
| Q |
223 |
gaa |
225 |
Q |
| |
|
||| |
|
|
| T |
47426489 |
gaa |
47426487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 222 - 275
Target Start/End: Complemental strand, 47426457 - 47426404
Alignment:
| Q |
222 |
tgaaattggaatttttgtaacaaaacttgatgtatgttttgtggcaatgctata |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
47426457 |
tgaaattggaatttttgtaacaaaacttgatgtatgttttgtagcaatgctata |
47426404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University