View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3588_low_3 (Length: 318)
Name: NF3588_low_3
Description: NF3588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3588_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 1 - 311
Target Start/End: Complemental strand, 19603112 - 19602803
Alignment:
| Q |
1 |
tttgttgcaaaggcttttggaagattaggaaattcagtgaagaaattgtctaaggttgtttcggaagaggtacctggaactttatcttctctcaaacttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19603112 |
tttgttgcaaaggcttttggaagattaggaaattcagtgaagaaattgtctaaggttgtttcggaagaggtacctggaactttatcttctctcaaacttt |
19603013 |
T |
 |
| Q |
101 |
ctagtttggagctcagtgatttgtcacagcaattaaacagtctcaggtaacacataattcgatcacggtttatttatcaccaacattttatattgatggc |
200 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
19603012 |
ctagtttggagcttagtgatttgtcacagcaattaaacagtctcaggtaacacataattcgatcacggtttatttatcaccgacattttatattgatggc |
19602913 |
T |
 |
| Q |
201 |
gtgtcagtgactagtctcaacacgcaagcatgttgttacaatcaattatatatattttttaaaaattataaaccgattctatgtgtcagtgtcgtgtctt |
300 |
Q |
| |
|
||||||||||||||||| |||||| || ||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
19602912 |
gtgtcagtgactagtctgaacacgaaaccatgttgttacaatcaattatatatat-ttttaaaaattattaaccgattctatgtgtcagtgttgtgtctt |
19602814 |
T |
 |
| Q |
301 |
gtgtctgtgct |
311 |
Q |
| |
|
||||||||||| |
|
|
| T |
19602813 |
gtgtctgtgct |
19602803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University