View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3589_high_11 (Length: 263)
Name: NF3589_high_11
Description: NF3589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3589_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 17 - 247
Target Start/End: Complemental strand, 25613661 - 25613431
Alignment:
| Q |
17 |
aaattgtaggattcaacttcaaggtgatactactggagagatgaaattccacaacactgcgttgttttgcggcttctacccatgcagagaaaatgcggct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| || || ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
25613661 |
aaattgtaggattcaacttcaaggtgatactattggagagatgaaattcctcaacactacgctgatttgcagcttctacccatgcagagaaaatgcggct |
25613562 |
T |
 |
| Q |
117 |
accattcttacaaaatccaaagcgacaatttatgtaaaacgttttgatgggatggttttgttctcgaggagagagcatgaatgcattcaccatgcgacag |
216 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| |||| |||||||||||||||| |||||||||||| |||||| |
|
|
| T |
25613561 |
accattcttacaaaatccaaagcgacagtttatgtaaaacgttttgatgggatgatttggttcccgaggagagagcatgactgcattcaccatacgacag |
25613462 |
T |
 |
| Q |
217 |
aagctattgaagtggctgcagtctcgcacag |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
25613461 |
aagctattgaagtggctgcagtctcgcacag |
25613431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 50 - 102
Target Start/End: Complemental strand, 31261782 - 31261730
Alignment:
| Q |
50 |
tggagagatgaaattccacaacactgcgttgttttgcggcttctacccatgca |
102 |
Q |
| |
|
||||||||| ||||||| |||| | ||| ||||| |||||||||||||||||| |
|
|
| T |
31261782 |
tggagagattaaattcctcaactcggcgctgtttagcggcttctacccatgca |
31261730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University