View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3589_high_14 (Length: 249)
Name: NF3589_high_14
Description: NF3589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3589_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 4 - 234
Target Start/End: Original strand, 45167559 - 45167793
Alignment:
| Q |
4 |
tatacaatatcaattcatctgatcttgtttcgatggaagaaactcccttttgcattgatgtagttatgactttagatttgaagtcatat----catgatg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
45167559 |
tatacaatatcaattcatctgatcttgtttcgatggaagaaactcccttttgcattgatgtagttatgactttagatttgaagtcatatatatcatgatg |
45167658 |
T |
 |
| Q |
100 |
aatgaagtagagttttttgtnnnnnnnttatacaaaatatatctagatccaaatttctcacttttgttttatttttcgttagacacaccgttaacgttat |
199 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45167659 |
aatgaagtagagttttttgtaaaaaaattatacaaaatatatctagatccaaatttctcacttttgttttattttttgttagacacaccgttaacgttat |
45167758 |
T |
 |
| Q |
200 |
ggtaggtatcgaagacgggactatatgttcaaatt |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
45167759 |
ggtaggtatcgaagacgggactatatgttcaaatt |
45167793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University