View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3589_high_18 (Length: 239)
Name: NF3589_high_18
Description: NF3589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3589_high_18 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 7 - 235
Target Start/End: Original strand, 8477335 - 8477563
Alignment:
| Q |
7 |
gtgagatgaatgaaaaatctcattacggaaattgtttgcaacattttaattctattgttgaatatgttaaggaagctcaaggattccttaagattggaga |
106 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8477335 |
gtgatatgaatgaaaaatctcattacggaaattgtttgcaacattttaattctattgttgaatatgttaaggaagctgaaggattccttaagattggaga |
8477434 |
T |
|
| Q |
107 |
ttatgaagatgttcatatgaatgcaaattttatcataattaatgttgatgattgtctttttggagattcaccaagtgaccctccttttcatgatacatct |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
8477435 |
ttatgaagatgttcatatgaatgcaaattttatcataattaatgttgatgattgtctttttggagattcaccaagtgaccctccttttcatgatacctct |
8477534 |
T |
|
| Q |
207 |
atgcttccaaaatatgctgatgatgtcca |
235 |
Q |
| |
|
|||||||||||||||||||||| |||||| |
|
|
| T |
8477535 |
atgcttccaaaatatgctgatgttgtcca |
8477563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 125 - 221
Target Start/End: Complemental strand, 8633818 - 8633722
Alignment:
| Q |
125 |
gaatgcaaattttatcataattaatgttgatgattgtctttttggagattcaccaagtgaccctccttttcatgatacatctatgcttccaaaatat |
221 |
Q |
| |
|
||||||| ||| |||||||| |||| || | ||||| ||| |||||||||||| |||||||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
8633818 |
gaatgcagattctatcataactaatattaacaattgtatttatggagattcacctggtgaccctatatttcatgatacctctttgcttccaaaatat |
8633722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University