View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3589_low_16 (Length: 240)
Name: NF3589_low_16
Description: NF3589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3589_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 13 - 228
Target Start/End: Complemental strand, 45167195 - 45166983
Alignment:
| Q |
13 |
aatctctctccctctccctccatcaatccaaatccggtcaccaccactttgatgtgcactttgcactatatattttaatgtacaaaacannnnnnnn--a |
110 |
Q |
| |
|
|||||||||||||||||||||| ||| |||| |||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| | |
|
|
| T |
45167195 |
aatctctctccctctccctccaccaacccaactccggtcaccaccactttgatgtgcactttgcactatatactttgatgtacaaaacatttttttttta |
45167096 |
T |
|
| Q |
111 |
taagatatccttaattaagataaaagagacttgacttgtgtcatctatctaaatatttttggtttttgtgaacacaactttgatctaatgaacttgcgta |
210 |
Q |
| |
|
|||||||| || |||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
45167095 |
taagatatatttgattaagataaaagagacttg-----tgtcatctatctaaatatttttgatttttgtgaacacagctttgatctaatgaacttacgta |
45167001 |
T |
|
| Q |
211 |
tatacctcaccgcctctc |
228 |
Q |
| |
|
||||| |||||||||||| |
|
|
| T |
45167000 |
tatacttcaccgcctctc |
45166983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University