View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3589_low_21 (Length: 225)

Name: NF3589_low_21
Description: NF3589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3589_low_21
NF3589_low_21
[»] chr5 (1 HSPs)
chr5 (38-208)||(9415657-9415827)


Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 38 - 208
Target Start/End: Complemental strand, 9415827 - 9415657
Alignment:
38 tgcatggttggttaacaacaattgaaaaagacggacctggtttgggtcaacttcattgttgtttgaggatgagactgtgtgtgtagcatacaaagcctgc 137  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9415827 tgcatggttggttaacaacaattgaaaaagacggacctggtttgggtcaacttcattgttgtttgaggatgagactgtgtgtgtagcatacaaagcctgc 9415728  T
138 accgccaacataatagatctattaggctcttttcataattatgacatgtgaattggtatacatcaagataa 208  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9415727 accgccaacataatacatctattaggctcttttcataattatgacatgtgaattggtatacatcaagataa 9415657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University