View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3589_low_21 (Length: 225)
Name: NF3589_low_21
Description: NF3589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3589_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 38 - 208
Target Start/End: Complemental strand, 9415827 - 9415657
Alignment:
| Q |
38 |
tgcatggttggttaacaacaattgaaaaagacggacctggtttgggtcaacttcattgttgtttgaggatgagactgtgtgtgtagcatacaaagcctgc |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9415827 |
tgcatggttggttaacaacaattgaaaaagacggacctggtttgggtcaacttcattgttgtttgaggatgagactgtgtgtgtagcatacaaagcctgc |
9415728 |
T |
 |
| Q |
138 |
accgccaacataatagatctattaggctcttttcataattatgacatgtgaattggtatacatcaagataa |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9415727 |
accgccaacataatacatctattaggctcttttcataattatgacatgtgaattggtatacatcaagataa |
9415657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University