View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3589_low_8 (Length: 281)
Name: NF3589_low_8
Description: NF3589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3589_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 265
Target Start/End: Complemental strand, 48187458 - 48187185
Alignment:
| Q |
1 |
aaagctaaaacaaatgcatcctttattattttatatttcaaatgttggatacagnnnnnnnnn-gtctaatatttggttcttaatagtattattgctgaa |
99 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
48187458 |
aaagttaaaacaaatgcatcctttattattttatatttcaaatgttggatacagaaaaaaaaaagtctaatatttggttcttaatagtattattgctgaa |
48187359 |
T |
 |
| Q |
100 |
tttttaaattgttcatgacactccctttctcatgctaggtcccctacacaatttatcaacccacatgt--------ttgatgtggagattcaacttacct |
191 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| ||||||||| |
|
|
| T |
48187358 |
tttttaaacagttcatgacactccctttctcatgctaggtcccctacacaatttatcaaaccacatgtttgtacaattgatgtggagatttaacttacct |
48187259 |
T |
 |
| Q |
192 |
atatgaaggtaaagtgtacgtagccagatgacagttgcacaatatttcttgcgaattttctctcagtaatttgt |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48187258 |
atatgaaggtaaagtgtacgtagccagatgacagttgcacaatatttcttgcgaattttctctcagtaatttgt |
48187185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University