View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3590_low_3 (Length: 313)

Name: NF3590_low_3
Description: NF3590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3590_low_3
NF3590_low_3
[»] chr7 (2 HSPs)
chr7 (172-245)||(21981323-21981396)
chr7 (247-297)||(21982602-21982652)


Alignment Details
Target: chr7 (Bit Score: 54; Significance: 5e-22; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 172 - 245
Target Start/End: Original strand, 21981323 - 21981396
Alignment:
172 cctacaaagaaatagaatggcatcgagaatgaatggagtcgaagaaggaaattcgaaaaagtaaatgaaatata 245  Q
    |||||||| ||||||||||||||||||||| |||||||| |||||||||||||| |||| ||||||||||||||    
21981323 cctacaaataaatagaatggcatcgagaataaatggagtggaagaaggaaattcaaaaaggtaaatgaaatata 21981396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 247 - 297
Target Start/End: Original strand, 21982602 - 21982652
Alignment:
247 tgacattgagagatttaacttgaagcccaacttcgatgtatacggataatg 297  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||    
21982602 tgacattgagagatttaacttgaagcccaacttcaatgtatacggataatg 21982652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University