View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3590_low_4 (Length: 243)
Name: NF3590_low_4
Description: NF3590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3590_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 15 - 228
Target Start/End: Complemental strand, 7668448 - 7668235
Alignment:
| Q |
15 |
cagagaatatgattctgcagagggatatatatgatagagacattatcaacacttggggaattgggagagttactttattaggagatgcagcacatccaat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7668448 |
cagagaatatgattctgcagagggatatatatgatagagacattatcaacacttggggaattgggagagttactttattaggagatgcagcacatccaat |
7668349 |
T |
 |
| Q |
115 |
gcaaccaaatcttggtctagggggatgtatggcaattgaggtatgttatatcaacttataatttagccctatcactggtttttacttaaaattatcttat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
7668348 |
gcaaccaaatcttggtctagggggatgtatggcaattgaggtatgttatatcaacttataatttagccctatcacttgtttttacttaaaaatatcttat |
7668249 |
T |
 |
| Q |
215 |
tttctattattcat |
228 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
7668248 |
tttctattattcat |
7668235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 50 - 82
Target Start/End: Original strand, 32789586 - 32789618
Alignment:
| Q |
50 |
agagacattatcaacacttggggaattgggaga |
82 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
32789586 |
agagacattatcaacacttggggaattgggaga |
32789618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University