View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3593_high_20 (Length: 373)
Name: NF3593_high_20
Description: NF3593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3593_high_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 13 - 272
Target Start/End: Complemental strand, 18886815 - 18886553
Alignment:
| Q |
13 |
aatatattttgagggaaagttatccaaaaaa-tggttgttcaaataaaaatactctttaattttactttacaattttctaaccagctgttttcgacatct |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18886815 |
aatatattttgagggaaagttatccaaaaaaatggttgttcaaataaaaatactctttaattttactttacaattttctaaccagctgttttcgacatct |
18886716 |
T |
 |
| Q |
112 |
ttttgcttgaaagaaaagcga---ttatggtggatcaatagcctttttaaattattactatgaaggataaacgaaaggtactgctaaaaaatgagctaag |
208 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
18886715 |
ttttgcttgaaagaaaagcgattattatggtggagcaatagcctttttaaattattactatgaaggataaacgaaaggtactgctaaaaaatgaactaag |
18886616 |
T |
 |
| Q |
209 |
ctttggatatgtttatttttatgatttatgtgtcactttgccttgcattaaaagggaggcattc |
272 |
Q |
| |
|
| ||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18886615 |
cattggatatgttta-ttttatgatttatgtgtcactttgtcttgcattaaaagggaggcattc |
18886553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 313 - 358
Target Start/End: Complemental strand, 18886533 - 18886489
Alignment:
| Q |
313 |
ggaggtattgttatttattttctaacaaaaggagggtattcttatt |
358 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
18886533 |
ggaggtattgttatttattttcttacaaaagga-ggtattcttatt |
18886489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University