View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3593_high_38 (Length: 242)
Name: NF3593_high_38
Description: NF3593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3593_high_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 5 - 235
Target Start/End: Original strand, 6580278 - 6580509
Alignment:
| Q |
5 |
tcaagaaggctgatgatgttgattctattgagaagg-aaaatagcacagcaatttcgcgatacacgtaacatgagaaagcatataccaagaaccaacagg |
103 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6580278 |
tcaagaagactgatgatgttgattctattgagaagggaaaatagcacagcaatttcgcgatacacgtaacatgagaaagcatataccaagaaccaacagg |
6580377 |
T |
 |
| Q |
104 |
aaagctagagtagaggcagaaagaggcaagatagctaaccagcgggctcnnnnnnntttgccggcataggaggtctattaggattaactagaacccgcaa |
203 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6580378 |
aaagctagagtagaggcagaaagaggcaaaatagctaaccagcgggctcaaaaaaatttgccggcataggaggtctattaggattaactagaacccgcaa |
6580477 |
T |
 |
| Q |
204 |
tctccaaactttcatatttccatcctttgata |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
6580478 |
tctccaaactttcatatttccatcctttgata |
6580509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University