View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3593_low_29 (Length: 293)
Name: NF3593_low_29
Description: NF3593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3593_low_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 14 - 286
Target Start/End: Complemental strand, 18887265 - 18886987
Alignment:
| Q |
14 |
acagacgagcaccgagtgtccg----aacgctagttaactataaagaaaaaagtgtgtatagctcatttagattg----gtttgatgatgcttttctcaa |
105 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
18887265 |
acagacgagcaccgagtgtccgtctgaacgctagttaactataaagaaaaaggtgtgtatagctcatttagattgattggtttgatgatgcttctctcaa |
18887166 |
T |
 |
| Q |
106 |
ggttacaaatttgattcttgtcaccaattacggtggaccaatacattcacaactttgctctgattttaaaattattcccgcaagtggacggtggaaatca |
205 |
Q |
| |
|
||||||||||||||||||||||| ||| |||| ||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18887165 |
ggttacaaatttgattcttgtcaacaagtacgatggactaatacattcagaactttgctctgattttaaaattattcccgcaagtggacggtggaaatca |
18887066 |
T |
 |
| Q |
206 |
accctcaaattagttggtaggctcgataccaagttatnnnnnnntagtgtttatcgttgggttccttttgaaatattatgg |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18887065 |
accctcaaattagttggtaggctcgataccgagtta--aaaaaatagtgtttatcgttgggttccttttgaaatattatgg |
18886987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University