View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3593_low_33 (Length: 252)
Name: NF3593_low_33
Description: NF3593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3593_low_33 |
 | |
|
| [»] chr1 (3 HSPs) |
| |
|
| [»] scaffold0274 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 252
Target Start/End: Original strand, 41430463 - 41430697
Alignment:
| Q |
18 |
ggagaagtatcgggcagttaaccttttcgatatgttgtttatggtttagggtttaaatttaggctattgtatgatgggaatatgaatggttttaaaaact |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
41430463 |
ggagaagtatcgggcagttaaccttttcgatatgttgtttatggtttagggtttaaatttaggctgttgtatgatgggaatatgaatgattttaaaaact |
41430562 |
T |
|
| Q |
118 |
gatcagggctgtgatttttagtgcaacattaggtttttgatgtatgcagccgcgatcacaattgcggtagcatactagcatctaccctaattaaggatca |
217 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
41430563 |
tatcagggctgtgatttttactgcaacattaggtttttgatgtatgcagccgcgatcacaattgcggtagcatactagcatcaaccctaattaaggatca |
41430662 |
T |
|
| Q |
218 |
tggctgcaactgcaactgtagaggaactagaccgc |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
41430663 |
tggctgcaactgcaactgtagaggaactagaccgc |
41430697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 35 - 78
Target Start/End: Original strand, 41440188 - 41440231
Alignment:
| Q |
35 |
ttaaccttttcgatatgttgtttatggtttagggtttaaattta |
78 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41440188 |
ttaaccctttggatatgttgtttatggtttagggtttaaattta |
41440231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 108 - 187
Target Start/End: Original strand, 41440228 - 41440309
Alignment:
| Q |
108 |
tttaaaaactgatc-agggctgtgatttttagtgcaacatt-aggtttttgatgtatgcagccgcgatcacaattgcggtag |
187 |
Q |
| |
|
|||||||| ||||| |||||||||||| | ||||||||| |||||||||||| |||||||||||||| ||||||| |||| |
|
|
| T |
41440228 |
tttaaaaattgatctagggctgtgattgtggctgcaacatttaggtttttgatgcatgcagccgcgatcgcaattgcagtag |
41440309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0274 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: scaffold0274
Description:
Target: scaffold0274; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 252
Target Start/End: Complemental strand, 14420 - 14186
Alignment:
| Q |
18 |
ggagaagtatcgggcagttaaccttttcgatatgttgtttatggtttagggtttaaatttaggctattgtatgatgggaatatgaatggttttaaaaact |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
14420 |
ggagaagtatcgggcagttaaccttttcgatatgttgtttatggtttagggtttaaatttaggctgttgtatgataggaatatgaatggttttaaaaact |
14321 |
T |
|
| Q |
118 |
gatcagggctgtgatttttagtgcaacattaggtttttgatgtatgcagccgcgatcacaattgcggtagcatactagcatctaccctaattaaggatca |
217 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
14320 |
gatcagggctgtgatttttactgcaacattaggtttttgatatatgcagccgcgatcacaattgcggtagcatactagcatcaaccctaattaaggatca |
14221 |
T |
|
| Q |
218 |
tggctgcaactgcaactgtagaggaactagaccgc |
252 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
14220 |
tggctgcaactgcaactgtgcaggaactagaccgc |
14186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 91 - 229
Target Start/End: Original strand, 33368368 - 33368505
Alignment:
| Q |
91 |
atgggaatatgaatggttttaaaaactgatcagggctgtgatttttagtgcaacatt-aggtttttgatgtatgcagccgcgatcacaattgcggtagca |
189 |
Q |
| |
|
|||||||| || |||||||||||||||||| ||||||||||| | ||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33368368 |
atgggaatctggatggttttaaaaactgat--gggctgtgattatggctgcaacatttaggtttttgatgtatgcagccgcgatcacaattgcggtagca |
33368465 |
T |
|
| Q |
190 |
tactagcatctaccctaattaaggatcatggctgcaactg |
229 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
33368466 |
tactagcatcaaccctaattaaggatcatggctgcgactg |
33368505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University