View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3593_low_42 (Length: 234)
Name: NF3593_low_42
Description: NF3593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3593_low_42 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 30980627 - 30980845
Alignment:
| Q |
1 |
aattacattggtctttcaaatggtgaggaaacggtggcctccaaagaaggagatgtggtgctcatgaaaacaatgcaactaacaaatgttctatgtgtgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30980627 |
aattacattggtctttcaaatggtgaggaaacggtggcctccaaagaaggaaatgtggtgctcgtgaaaacaatgcaaccaacaaatgttctatgtgtgt |
30980726 |
T |
 |
| Q |
101 |
ccaatctgcaatgcaaattgatttcagtatctcaactgcttaaagatactaattacatggtccattctacttacaaattttgtctcatacatgaccccac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| ||||||| ||||| |
|
|
| T |
30980727 |
ccaatctgcaatgcaaattgatttcagtatctcaactgcttaaagatactaattacatggtccattttacttacaagttttgtctcttacatgatcccac |
30980826 |
T |
 |
| Q |
201 |
tttctgaagaatgtccatt |
219 |
Q |
| |
|
|||| |||||||||||||| |
|
|
| T |
30980827 |
tttccgaagaatgtccatt |
30980845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University