View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3593_low_49 (Length: 212)
Name: NF3593_low_49
Description: NF3593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3593_low_49 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 14 - 197
Target Start/End: Original strand, 8181018 - 8181201
Alignment:
| Q |
14 |
agcaaaggatgccaatatcatttctcacatctccagtgatgcaattttggtacaagatgcaatcggtgacaaagtatatactgattttactcttctaata |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8181018 |
agcaaaggatgccaatatcatttctcacatctccagtgatgcaattttggtacaagatgcaattggtgacaaagtatatactgattttactcttctaata |
8181117 |
T |
|
| Q |
114 |
taatcaactcagtttaacatttcagtatgatcataattttttacgcatgtgcacataacatcaacaaacgtctgattcgttgtt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8181118 |
taatcaactcagtttaacatttcagtatgatcataattttttacgcatgtgcacataacatcaacaaacgtctgattcgttgtt |
8181201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University