View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3594_high_29 (Length: 250)

Name: NF3594_high_29
Description: NF3594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3594_high_29
NF3594_high_29
[»] chr8 (2 HSPs)
chr8 (9-68)||(2529269-2529328)
chr8 (14-66)||(2538893-2538945)


Alignment Details
Target: chr8 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 9 - 68
Target Start/End: Complemental strand, 2529328 - 2529269
Alignment:
9 agcacagagattagtcgttgcagatagccgggcttttattctagcaatgcgcaaactatg 68  Q
    |||| |||||||||||||||||||||||||  ||||||||||||||||||||||||||||    
2529328 agcaaagagattagtcgttgcagatagccgaccttttattctagcaatgcgcaaactatg 2529269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 14 - 66
Target Start/End: Complemental strand, 2538945 - 2538893
Alignment:
14 agagattagtcgttgcagatagccgggcttttattctagcaatgcgcaaacta 66  Q
    |||||||||||  ||| ||||||||| |||||| |||||||||||||||||||    
2538945 agagattagtcaatgcggatagccggacttttactctagcaatgcgcaaacta 2538893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University