View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3594_high_38 (Length: 229)
Name: NF3594_high_38
Description: NF3594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3594_high_38 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 12 - 211
Target Start/End: Original strand, 37375799 - 37375990
Alignment:
| Q |
12 |
aagaatatatgtgtcccattggttttatggcaacgtgaaatcgtgaagtgttgctgctaacaaaaacttcagcatggaattcaagcacatgtcagatcag |
111 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| ||||||| |
|
|
| T |
37375799 |
aagaatatatgtgtcccattggttttaaggcaacgtgaaatcgtgaagtgttgctgcta--------ttcagcatggaattcaagcacgtgttagatcag |
37375890 |
T |
 |
| Q |
112 |
atctgtacattacaattacaaagaatggataagaagtataattaacttatttgtttatttatttaccaaactgcaattcaatatttttgtatacccttag |
211 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37375891 |
atctgtacattacaattacaaacaatggataagaagtataattaacttatttgtttatttatttaccaaactgcaattcaatatttttgtatacccttag |
37375990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University