View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3594_low_14 (Length: 361)
Name: NF3594_low_14
Description: NF3594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3594_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 5e-84; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 5e-84
Query Start/End: Original strand, 183 - 344
Target Start/End: Complemental strand, 31532344 - 31532183
Alignment:
| Q |
183 |
catagttggtggccacataggattccattatatgtatacccatttgcctcacttcttctcatgattgatccttctttagtgaaggtgctcagtaaagtta |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31532344 |
catagttggtggccacataggattccattatatgtatacccatttgcctcacttcttctcatgattgatccttcttttgtgaaggtgctcagtaaagtta |
31532245 |
T |
 |
| Q |
283 |
ctcttcttgattcatttcattccaaatgagagagacatgtttgaaatcacgtttataattag |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31532244 |
ctcttcttgattcatttcattccaaatgagagagacatgtttgaaatcacgtttataattag |
31532183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 1 - 122
Target Start/End: Complemental strand, 31532456 - 31532335
Alignment:
| Q |
1 |
tgagtgaccaaaatgcccttgtttggtgcctttttctgtctattaaagtcatattgaacctggtaatttagaaaatggagacggtacatttgccaattca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31532456 |
tgagtgaccaaaatgcccttgtttggtgcctttttctgtctattaaagtcatattgaacctggtaatttagaaaatggagagggtacatttgccaattca |
31532357 |
T |
 |
| Q |
101 |
ggtgttccattccatagttggt |
122 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
31532356 |
ggtgttccattccatagttggt |
31532335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University