View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3594_low_24 (Length: 261)
Name: NF3594_low_24
Description: NF3594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3594_low_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 20 - 255
Target Start/End: Original strand, 40104529 - 40104769
Alignment:
| Q |
20 |
aagactacttggagatatctttaaaaatactcttgttttcttcacgtacgctctttagtataannnnnnn--gatatttttgatcaaaactatactacca |
117 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |||| ||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
40104529 |
aagactacttggaggtatctttaaaaatactcttgttttctccacgcacgctctttagtatacatttcttttgat-tttttgatcaaaactatactacca |
40104627 |
T |
 |
| Q |
118 |
taaaaatt-catcactta---tttcagtacattcctcgtttaaattgtcataatccagccggtccctataattcagaaaaattagtaatgtgatcgaaat |
213 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
40104628 |
taaaaatttcatcacttagtatttcagtacattcctcgtttaaattgtcataatccagccggtccatataattcaaaaaaattagtaatgtgatcgaaat |
40104727 |
T |
 |
| Q |
214 |
gttacctatagaattagaatttgacttggctaacacattttt |
255 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40104728 |
gtcacctatagaattagaatttgacttggctaacacattttt |
40104769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University