View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3594_low_29 (Length: 250)
Name: NF3594_low_29
Description: NF3594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3594_low_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 9 - 68
Target Start/End: Complemental strand, 2529328 - 2529269
Alignment:
| Q |
9 |
agcacagagattagtcgttgcagatagccgggcttttattctagcaatgcgcaaactatg |
68 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2529328 |
agcaaagagattagtcgttgcagatagccgaccttttattctagcaatgcgcaaactatg |
2529269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 14 - 66
Target Start/End: Complemental strand, 2538945 - 2538893
Alignment:
| Q |
14 |
agagattagtcgttgcagatagccgggcttttattctagcaatgcgcaaacta |
66 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
2538945 |
agagattagtcaatgcggatagccggacttttactctagcaatgcgcaaacta |
2538893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University